WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00037840 CGC Received  2018-06-26
Genotype  cey-1(gk5004[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  VC3925
Outcrossed  x0 Remark  Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details.
Species  Caenorhabditis elegans

1 Alleles

Public Name
gk5004

1 Data Sets

Name URL
WormBaseAcedbConverter  

4 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000472 cey-1 F33A8.3 Caenorhabditis elegans
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans