WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00037915 CGC Received  2019-03-15
Genotype  hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  VC4098
Outcrossed  x1 Remark  Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Species  Caenorhabditis elegans

1 Alleles

Public Name
gk5045

1 Data Sets

Name URL
WormBaseAcedbConverter  

5 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001067 dpy-5 F27C1.8 Caenorhabditis elegans
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans
WBGene00017816 hrpk-1 F26B1.2 Caenorhabditis elegans