WormMine: Gene WBGene00055907

• WormBase Gene ID: WBGene00055907
• Gene Name: CRE04882
• Sequence Name: CRE04882
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Testis-expressed protein 10/pre-rRNA-processing protein Ipi1; Pre-rRNA-processing protein Ipi1, N-terminal; Armadillo-type fold; Rix1 complex component involved in 60S ribosome maturation; and Armadillo-like helical. Is an ortholog of C. elegans Y48A6C.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04882.1	CRE04882.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04882	CRE04882		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107249
• Remark: CRE04882, TTCAAAATCTCACACAGTTTCTCCGTTTGAATTACCAGACGCTCTTCTCAATCTTTCAGC, WBGene00055907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term