WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00055840 Gene Name  Cre-cut-6
Sequence Name  ? CRE04637 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: von Willebrand factor, type A; Zona pellucida domain; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans cut-6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE04637.1 CRE04637.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE04637 CRE04637   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-cut-6, AGTGAAAGTTCAATGTTTTTATATGGAAGCAGATAAGCATGTTACTGTTCCATTATCTGT, WBGene00055840   Expr1116611 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term