WormMine: Gene WBGene00078954

• WormBase Gene ID: WBGene00078954
• Gene Name: CRE30364
• Sequence Name: CRE30364
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Inhibitor of growth proteins N-terminal histone-binding and Inhibitor of growth protein, N-terminal histone-binding. Is an ortholog of C. elegans lsy-13. In C. elegans, lsy-13 is involved in cell fate specification; maintenance of left/right asymmetry; and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30364.1	CRE30364.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30364	CRE30364		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116233
• Remark: CRE30364, CAGGAAGAATTGGATGATGGAAATGGAGAGATTCTCAATGAGATGTTGGATGAGGATGAT, WBGene00078954
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term