WormMine: Gene WBGene00055676

• WormBase Gene ID: WBGene00055676
• Gene Name: Cre-lon-1
• Sequence Name: CRE04758
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Cysteine-rich secretory protein family; CAP superfamily; CAP domain; and Cysteine-rich secretory protein-related. Is an ortholog of C. elegans lon-1. In C. elegans, lon-1 is involved in several processes, including negative regulation of BMP signaling pathway; negative regulation of DNA endoreduplication; and positive regulation of growth rate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04758.1	CRE04758.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04758	CRE04758		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102236
• Remark: Cre-lon-1, ATGCTCCAGCATGTTATCAAGGACTTTGCTATATGCCGAAGAACTACGAACACCCAACTA, WBGene00055676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term