WormMine: Gene WBGene00058931

• WormBase Gene ID: WBGene00058931
• Gene Name: CRE30786
• Sequence Name: CRE30786
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: NACHT domain; Domain of unknown function (DUF4062); WD40/YVTN repeat-like-containing domain superfamily; NACHT nucleoside triphosphatase; WD40 repeat; Quinoprotein alcohol dehydrogenase-like superfamily; Domain of unknown function DUF4062; and WD domain, G-beta repeat. Is an ortholog of C. elegans T05C3.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30786.1	CRE30786.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30786	CRE30786		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109397
• Remark: CRE30786, CACAGGATGGCTCTCTTTTGACTGTTGTACTGAATGATCCGCTTGCAAAAGAAGAAACTT, WBGene00058931
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term