WormMine: Gene WBGene00058857

• WormBase Gene ID: WBGene00058857
• Gene Name: CRE30824
• Sequence Name: CRE30824
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Phosphoglycolate phosphatase-like, domain 2; HAD-like superfamily; Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal; HAD superfamily; Haloacid dehalogenase-like hydrolase; and HAD hydrolase, subfamily IA. Is an ortholog of C. elegans C04E6.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30824.1	CRE30824.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30824	CRE30824		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113287
• Remark: CRE30824, TGTTCTTGAATCATGTAAGGAAGGTGTGAAGAAGCCGGATCCAAGATTCTACCAAGTCGC, WBGene00058857
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term