WormMine: Gene WBGene00058543

• WormBase Gene ID: WBGene00058543
• Gene Name: Cre-atrn-1
• Sequence Name: CRE15306
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Galactose oxidase/kelch, beta-propeller; EGF-like domain; CUB domain; Laminin EGF domain; Kelch motif; Kelch repeat type 1; PSI domain; Spermadhesin, CUB domain superfamily; Laminin-type EGF domain; and Plexin repeat. Is an ortholog of C. elegans atrn-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15306.1	CRE15306.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15306	CRE15306		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093581
• Remark: Cre-tag-53, GCGGTGGACTTCATTTTCACATTCAAGTTGAAGGCTGACGATAAAGACAACCACACGAGT, WBGene00058543
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term