WormMine: Gene WBGene00057473

• WormBase Gene ID: WBGene00057473
• Gene Name: CRE11721
• Sequence Name: CRE11721
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Major sperm protein (MSP) domain; Immunoglobulin-like fold; MSP (Major sperm protein) domain; and PapD-like superfamily. Is an ortholog of C. elegans Y59H11AM.1; Y59E9AR.1; and msp-76.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11721.1	CRE11721.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11721	CRE11721		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE
	Proteins expressed in unactivated C. remanei spermatids.	N.A	WBPaper00054996:unactivated_spermatid_CRE

1 Expression Patterns

• Primary Identifier: Expr1105373
• Remark: CRE11721, CATTAAGGTGATCAACTCGTCTGCTCGCAGAGTTGGATATGGTATCAAGACCACCAACAT, WBGene00057473
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term