WormMine: Gene WBGene00066009

• WormBase Gene ID: WBGene00066009
• Gene Name: Cre-gtsf-1
• Sequence Name: CRE30384
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: TRM13/UPF0224 family, U11-48K-like CHHC zinc finger domain; U11-48K-like CHHC zinc finger; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans gtsf-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30384.1	CRE30384.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30384	CRE30384		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102502
• Remark: CRE30384, ATGTGGAAGAGACGATGAACAGATTGGAGTATTTGGAGATGAAGAATCACGAATTGAGTG, WBGene00066009
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term