WormMine: Gene WBGene00034883

• WormBase Gene ID: WBGene00034883
• Gene Name: Cbr-nck-1
• Sequence Name: CBG14353
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SH2 domain superfamily; SH3 domain; SH3-like domain superfamily; Variant SH3 domain; Cytoplasmic protein NCK; and SH2 domain. Is an ortholog of C. elegans nck-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14353.1	CBG14353.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14353	CBG14353		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058529
• Remark: Cbr-nck-1, AGAATTGGAAACCGGACGTTCCCAAACATGCACGCGCTCATCAGCCACTACACAACCAAT, WBGene00034883
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term