Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE29430.1 | CRE29430.1 | [unknown] |
Other
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. | N.A | WBPaper00054996:membranous_oraganelle_CRE |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CRE29430, AAACAGCGACGCAGCAACACCAGAAGCACCAGCCGAAGGAGGAAATGGAACCAGCTCCTC, WBGene00086131 | Expr1097864 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Expr13699 | Crem-MSS-1::HA expression was first detected in large vesicles and on the plasma membrane of spermatocytes, with intensity increasing and localization restricted to secretory vesicles in mature spermatids. The secretory vesicles of nematode sperm, known as membranous organelles (MOs), fuse with the plasma membrane upon ejaculation and sperm activation. |