WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00182724 Gene Name  CJA27152
Sequence Name  ? CJA27152 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: SET domain. Is an ortholog of C. elegans met-1. In C. elegans, met-1 is involved in negative regulation of transcription by RNA polymerase II and negative regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA27152b.1 CJA27152b.1   [unknown]
Transcript:CJA27152a.1 CJA27152a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA27152a CJA27152a   [unknown]
CDS:CJA27152b CJA27152b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA21141, CACACTTAAAAATTGCTTTTGGGCATAGATGCAAAGGGCCGGGCCTGGCCGGACACAGAA, WBGene00176713   Expr1071470 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-met-1, GGCAAATGTACAAACGAAGAAAGTTGATGGAGGAGCGAGAGTCTCGACACGCGGTTCGAT, WBGene00135273   Expr1081375 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term