WormMine: Gene WBGene00059989

• WormBase Gene ID: WBGene00059989
• Gene Name: Cre-fog-3
• Sequence Name: CRE29557
• Organism: Caenorhabditis remanei
• Automated Description: Expressed in male. Is an ortholog of C. elegans fog-3. In C. elegans, fog-3 is involved in cell fate specification; developmental process involved in reproduction; and positive regulation of oocyte development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29557.1	CRE29557.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29557	CRE29557		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1110759
• Remark: Cre-fog-3, GAAAAGTCTTCTTCCGTGGTTCTTTGGACGGGATCGAGGTCCCAATATGGAATGGAGAAG, WBGene00059989
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr11506
• Pattern: In C remanei both larval and adult males produce high levels of fog-3, but neither larval nor adult females produce detectable levels of this message.

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term