WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00059997 Gene Name  CRE29552
Sequence Name  ? CRE29552 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Inner centromere protein, ARK binding region and Inner centromere protein, ARK-binding domain. Is an ortholog of C. elegans icp-1. In C. elegans, icp-1 is involved in mitotic cytokinesis and nuclear division. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29552.1 CRE29552.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29552 CRE29552   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE29552, CTTGATTATGGGCTCGACTATTTGAGCAATGAAGAAGATACTGATGATGAATGTAATCCG, WBGene00059997   Expr1105217 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term