WormMine: Gene WBGene00131658

• WormBase Gene ID: WBGene00131658
• Gene Name: Cjp-frm-7
• Sequence Name: CJA12454
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12454.1	CJA12454.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12454	CJA12454		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085271
• Remark: Cjp-frm-7, GTTTTTATGTGAATGCCACGCCCACCGGAATTCTGTCACACCATAGAAGACCCTCGTCGT, WBGene00131658
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term