WormMine: Gene WBGene00025869

• WormBase Gene ID: WBGene00025869
• Gene Name: Cbr-shn-1
• Sequence Name: CBG02907
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Sterile alpha motif domain; PDZ domain; Ankyrin repeat; Sterile alpha motif/pointed domain superfamily; Domain of unknown function DUF3447; SAM domain (Sterile alpha motif); Ankyrin repeat-containing domain superfamily; PDZ superfamily; PDZ domain 6; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans shn-1. In C. elegans, shn-1 is involved in defecation and rhythmic behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02907.1	CBG02907.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02907	CBG02907		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060612
• Remark: Cbr-shn-1, GGTTGGCTTTCCTCTCTTCATTTATCCGAATATTCTCCAGCATTCCGAAATCAACGAATC, WBGene00025869
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term