WormMine: Gene WBGene00128567

• WormBase Gene ID: WBGene00128567
• Gene Name: CJA09363
• Sequence Name: CJA09363
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Aminopeptidase N-like , N-terminal domain superfamliy and Peptidase M1 N-terminal domain. Is an ortholog of C. elegans Y53F4B.20.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09363c.1	CJA09363c.1		[unknown]
Transcript:CJA09363b.1	CJA09363b.1		[unknown]
Transcript:CJA09363a.1	CJA09363a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09363a	CJA09363a		[unknown]
CDS:CJA09363b	CJA09363b		[unknown]
CDS:CJA09363c	CJA09363c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084318
• Remark: CJA09363, GACTTGCTCATGATGCTCTCAATGATCTTTGTACAAAACTTTATGGTGTTTCATGCTTGT, WBGene00128567
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term