WormMine: Gene WBGene00131030

• WormBase Gene ID: WBGene00131030
• Gene Name: Cjp-abcx-1
• Sequence Name: CJA11826
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: P-loop containing nucleoside triphosphate hydrolase. Is an ortholog of C. elegans abcx-1. In C. elegans, abcx-1 is involved in positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11826b.1	CJA11826b.1		[unknown]
Transcript:CJA11826a.1	CJA11826a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11826b	CJA11826b		[unknown]
CDS:CJA11826a	CJA11826a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075483
• Remark: CJA11826, CATCTCGTGAGTCATCTGTACGGATTGCGAGATTGGTAAATAAATGGAATCAATCGGCAC, WBGene00131030
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term