WormMine: Gene WBGene00060108

• WormBase Gene ID: WBGene00060108
• Gene Name: Cre-ran-4
• Sequence Name: CRE29482
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: NTF2-like domain superfamily; Nuclear transport factor 2 domain; and Nuclear transport factor 2 (NTF2) domain. Is an ortholog of C. elegans ran-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29482.1	CRE29482.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29482	CRE29482		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115046
• Remark: Cre-ran-4, TCCAAACAACCAAGGATCGTACTTCATCGGAAACGAGATCTTCCGGCTCGATTTGCACAA, WBGene00060108
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term