WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134453 Gene Name  Cjp-fem-1.1
Sequence Name  ? CJA15249 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ankyrin repeat-containing domain superfamily; Tetratricopeptide-like helical domain superfamily; and Ankyrin repeat. Is an ortholog of C. elegans fem-1. In C. elegans, fem-1 is involved in several processes, including proteasome-mediated ubiquitin-dependent protein catabolic process; regulation of germ cell proliferation; and sex determination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15249.2 CJA15249.2   [unknown]
Transcript:CJA15249.1 CJA15249.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15249 CJA15249   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-fem-1, AAACTGATTGGTGCAACTTTTATGGACAAGAAAATGGATGCGATGGCGGCGATGGACTAT, WBGene00176686   Expr1085057 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA15249, ATCAAATACGCCGACTCGTTTGAAGGTGTCGAAACGATGCTGCCAAGAGAGCTCAAGGAT, WBGene00134453   Expr1089460 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term