WormMine: Gene WBGene00137331

• WormBase Gene ID: WBGene00137331
• Gene Name: CJA18127
• Sequence Name: CJA18127
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF1258 and Protein of unknown function (DUF1258).
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18127c.1	CJA18127c.1		[unknown]
Transcript:CJA18127b.1	CJA18127b.1		[unknown]
Transcript:CJA18127a.1	CJA18127a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18127c	CJA18127c		[unknown]
CDS:CJA18127a	CJA18127a		[unknown]
CDS:CJA18127b	CJA18127b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078764
• Remark: CJA18127, CTGGAATACTGTAGTGCCAATGGTGTATGCGGATATTGAAGGGACTGATTGCGAAATCAA, WBGene00137331
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term