WormMine: Gene WBGene00028221

• WormBase Gene ID: WBGene00028221
• Gene Name: Cbr-daf-42
• Sequence Name: CBG05845
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is an ortholog of C. elegans daf-42.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05845g.1	CBG05845g.1		[unknown]
Transcript:CBG05845h.1	CBG05845h.1		[unknown]
Transcript:CBG05845a.1	CBG05845a.1		[unknown]
Transcript:CBG05845b.1	CBG05845b.1		[unknown]
Transcript:CBG05845e.1	CBG05845e.1		[unknown]
Transcript:CBG05845f.1	CBG05845f.1		[unknown]
Transcript:CBG05845c.1	CBG05845c.1		[unknown]
Transcript:CBG05845d.1	CBG05845d.1		[unknown]

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05845f	CBG05845f		[unknown]
CDS:CBG05845g	CBG05845g		[unknown]
CDS:CBG05845d	CBG05845d		[unknown]
CDS:CBG05845e	CBG05845e		[unknown]
CDS:CBG05845h	CBG05845h		[unknown]
CDS:CBG05845b	CBG05845b		[unknown]
CDS:CBG05845c	CBG05845c		[unknown]
CDS:CBG05845a	CBG05845a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1063958
• Remark: CBG05845, TAGCTCTGACAATGAACACATTCCTCAAGTCGTTGTACCGACAAGACCTTCGGGAGGTTT, WBGene00028221
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term