WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134951 Gene Name  CJA15747
Sequence Name  ? CJA15747 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srh and 7TM GPCR, serpentine receptor class h (Srh). Is an ortholog of C. elegans srh-218 and srh-219. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15747b.1 CJA15747b.1   [unknown]
Transcript:CJA15747c.1 CJA15747c.1   [unknown]
Transcript:CJA15747a.1 CJA15747a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15747b CJA15747b   [unknown]
CDS:CJA15747c CJA15747c   [unknown]
CDS:CJA15747a CJA15747a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA20269, CTGCGGAAGCTGGTAGGTTAAGTTCACACCTCGAACAGTTAGCTATACTTGTCAAATACG, WBGene00175841   Expr1072304 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA15747, CTACTCATGGATTCTTTTCCACAATCTCGCTTATCGTTATTCATACACCGTATAGAAAGT, WBGene00134951   Expr1088668 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26409, CTTATTCGGGAATAGCCGACGACCAAACAGACGCGAAAGCGTATGTGCATGAGGTAACAA, WBGene00181981   Expr1074664 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term