WormMine: Gene WBGene00025909

• WormBase Gene ID: WBGene00025909
• Gene Name: Cbr-bigr-1
• Sequence Name: CBG02952
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Phosphoglycolate phosphatase-like, domain 2; HAD-like superfamily; Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal; HAD superfamily; Haloacid dehalogenase-like hydrolase; and HAD hydrolase, subfamily IA. Is an ortholog of C. elegans bigr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02952.1	CBG02952.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02952	CBG02952		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063833
• Remark: CBG02952, AGAATATCGAAGCTGCGGAGAAGTTGGGATGGAATACCATCATGGTCAGTGACATCGAAA, WBGene00025909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term