WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121014 Gene Name  CJA01810
Sequence Name  ? CJA01810 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Collagen triple helix repeat (20 copies) and Collagen triple helix repeat. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01810.1 CJA01810.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01810 CJA01810   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26712, ACCGGAGCCCCAGGAGGTTGCGATCACTGCCCACCACCAAGAACCGCTCCAGGATATTAA, WBGene00182284   Expr1073122 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA01810, GACAACGGATCTGCTGGAGCCCCAGGACAGCCAGGAGCCAACGGAGACAATGGAGCCGAT, WBGene00121014   Expr1085973 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term