WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038554 Gene Name  Cbr-ehbp-1
Sequence Name  ? CBG19308 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Calponin homology (CH) domain; NT-type C2 domain; Calponin homology domain; bMERB domain; N-terminal C2 in EEIG1 and EHBP1 proteins; Bivalent Mical/EHBP Rab binding domain; and CH domain superfamily. Is an ortholog of C. elegans ehbp-1. In C. elegans, ehbp-1 is involved in endocytic recycling; protein secretion; and receptor recycling. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19308.1 CBG19308.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19308 CBG19308   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ehbp-1, ACTTCCCACGTTCCGATGAGAATAAGAGAGCAACTGATAAGCTGATGGAGGAATACAGTA, WBGene00038554   Expr1058044 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term