WormMine: Gene WBGene00029169

• WormBase Gene ID: WBGene00029169
• Gene Name: CBG06992
• Sequence Name: CBG06992
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ribonuclease Z/Hydroxyacylglutathione hydrolase-like; Metallo-beta-lactamase; Metallo-beta-lactamase superfamily; and Metallo-beta-lactamase domain-containing protein 1. Is an ortholog of C. elegans C23H3.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06992a.1	CBG06992a.1		[unknown]
Transcript:CBG06992b.1	CBG06992b.1		[unknown]
Transcript:CBG06992b.2	CBG06992b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06992a	CBG06992a		[unknown]
CDS:CBG06992b	CBG06992b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068924
• Remark: CBG06992, ATCAAGAGACAAAATGCGAATCTGATTGTTTGCATGGCCGATTGGATAGTTCCAGGACAC, WBGene00029169
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term