WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120056 Gene Name  Cjp-rbr-2
Sequence Name  ? CJA00852 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Lysine-specific demethylase-like domain; JmjC domain; C5HC2 zinc finger; PHD-finger; Zinc finger, PHD-type; Zinc finger, C5HC2-type; Zinc finger, PHD-finger; Zinc finger, RING/FYVE/PHD-type; JmjC domain, hydroxylase; PLU-1-like protein; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans rbr-2. In C. elegans, rbr-2 is involved in determination of adult lifespan and regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00852.1 CJA00852.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00852 CJA00852   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-rbr-2, CTTTACGAAAATTGGCTCCTGGATTGACGGGAAGACAAAGAGATCTGTTTCATCACATGA, WBGene00120056   Expr1085679 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23455, CGAGACGGTTCACGTACACCAACGGAAACGACATCTCAATTGACTGCCAAGTTGCAAATT, WBGene00179027   Expr1086363 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term