WormMine: Gene WBGene00037535

• WormBase Gene ID: WBGene00037535
• Gene Name: Cbr-wdr-48
• Sequence Name: CBG18038
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; WD40/YVTN repeat-like-containing domain superfamily; Domain of unknown function (DUF3337); WD40 repeat; WDR48/Bun107; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-48. In C. elegans, wdr-48 is involved in positive regulation of locomotion involved in locomotory behavior; positive regulation of macromolecule metabolic process; and positive regulation of protein localization to cell surface.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18038a.1	CBG18038a.1		[unknown]
Transcript:CBG18038b.1	CBG18038b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18038b	CBG18038b		[unknown]
CDS:CBG18038a	CBG18038a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052840
• Remark: CBG18038, AGTTGGAACCAGAAACGGATCTACGAACTGTCAAACACTTTTATTGGAAACAAAGCGGAG, WBGene00037535
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term