WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123979 Gene Name  Cjp-gly-6
Sequence Name  ? CJA04775 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Nucleotide-diphospho-sugar transferases; Glycosyltransferase 2-like; Glycosyl transferase family 2; Ricin B-like lectins; Ricin-type beta-trefoil lectin domain; and Ricin B, lectin domain. Is an ortholog of C. elegans gly-6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04775.1 CJA04775.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04775 CJA04775   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-gly-6, GTAAAAGTGGACTCTGCCTGACGTTGCCCGAAATATTCGACCCATCAAAAGACGAATTCA, WBGene00123979   Expr1091501 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term