WormMine: Gene WBGene00123610

• WormBase Gene ID: WBGene00123610
• Gene Name: CJA04406
• Sequence Name: CJA04406
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: CUB domain; C-type lectin-like/link domain superfamily; Lectin C-type domain; Spermadhesin, CUB domain superfamily; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans clec-264. In C. elegans, clec-264 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04406b.1	CJA04406b.1		[unknown]
Transcript:CJA04406a.1	CJA04406a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04406b	CJA04406b		[unknown]
CDS:CJA04406a	CJA04406a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079730
• Remark: CJA04406, GAACCAAACATTCACCAAACCGGTCACCAGAATCAGTGGTAATTTGACAACGCCGTGGAC, WBGene00123610
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term