WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123031 Gene Name  Cjp-lact-4
Sequence Name  ? CJA03827 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Beta-lactamase/transpeptidase-like; Beta-lactamase; and Beta-lactamase-related. Is an ortholog of C. elegans lact-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03827.1 CJA03827.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03827 CJA03827   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26797, AATCACAATCGCGTACCTCAGTAATGGATTAAAAGTTGGATTTGGTGACACTGCGAGGAC, WBGene00182369   Expr1087933 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-lact-4, AAAAGTTGGATTTGGTGACACTGCGAGGACGTACAAACGGCTATTGGAATCAGTTTATGA, WBGene00123031   Expr1086707 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term