WormMine: Gene WBGene00122840

• WormBase Gene ID: WBGene00122840
• Gene Name: CJA03636
• Sequence Name: CJA03636
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SGNH domain (fused to AT3 domains); Transposase, type 1; and Transposase (partial DDE domain). Is an ortholog of C. elegans oac-48; oac-57; and oac-58.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03636a.1	CJA03636a.1		[unknown]
Transcript:CJA03636c.1	CJA03636c.1		[unknown]
Transcript:CJA03636b.1	CJA03636b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03636a	CJA03636a		[unknown]
CDS:CJA03636c	CJA03636c		[unknown]
CDS:CJA03636b	CJA03636b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074144
• Remark: CJA03636, AATGCTACAGTACTTCGATAACACGGGATTCTCTTATTTCACTACACCAAATCACTTGTC, WBGene00122840
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term