WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028143 Gene Name  Cbr-tin-9.1
Sequence Name  ? CBG05752 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tim10/DDP family zinc finger; Tim10-like domain superfamily; and Tim10-like. Is an ortholog of C. elegans tin-9.1. In C. elegans, tin-9.1 is involved in protein insertion into mitochondrial inner membrane and regulation of growth. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05752.1 CBG05752.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05752 CBG05752   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tin-9.1, ACAACGGGTCTCTCAACGGTTCCAAGAACATCAAATACTGAACGCCCAAGCCAACGGAGC, WBGene00028143   Expr1067756 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term