WormMine: Gene WBGene00125539

• WormBase Gene ID: WBGene00125539
• Gene Name: Cjp-par-5
• Sequence Name: CJA06335
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans par-5. In C. elegans, par-5 is involved in several processes, including cell fate commitment; determination of adult lifespan; and establishment of localization in cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06335.2	CJA06335.2		[unknown]
Transcript:CJA06335.1	CJA06335.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06335	CJA06335		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082160
• Remark: Cjp-par-5, ACATCTGACGTTGTGGGAGATGATCAGGAGCAAGAAGGAAACGCTGATGCCGGAAATTAA, WBGene00125539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term