WormMine: Gene WBGene00125389

• WormBase Gene ID: WBGene00125389
• Gene Name: Cjp-cnnm-3
• Sequence Name: CJA06185
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Cyclin M transmembrane N-terminal domain and CNNM, transmembrane domain. Is an ortholog of C. elegans cnnm-3. In C. elegans, cnnm-3 is involved in several processes, including determination of adult lifespan; magnesium ion homeostasis; and positive regulation of developmental process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06185.1	CJA06185.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06185	CJA06185		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076397
• Remark: CJA06185, GAAAGGAAATCAGTTGTTGTGCACCCTGCTCATTGGAAACGTCATTGTCAATGTGGGAGT, WBGene00125389
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term