WormMine: Gene WBGene00067433

• WormBase Gene ID: WBGene00067433
• Gene Name: Cre-smu-2
• Sequence Name: CRE06350
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Protein Red-like; Protein RED, C-terminal; RED-like protein C-terminal region; RED-like, N-terminal; and RED-like protein N-terminal region. Is an ortholog of C. elegans smu-2. In C. elegans, smu-2 is involved in several processes, including mechanosensory behavior; nematode larval development; and regulation of alternative mRNA splicing, via spliceosome.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06350.1	CRE06350.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06350	CRE06350		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106766
• Remark: Cre-smu-2, CGGCAGTTTCGGAAGCGAAACGGTTGGATCGTGAGCTCAACGAGATCAATAAAATTATGG, WBGene00067433
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term