WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124200 Gene Name  Cjp-rme-8
Sequence Name  ? CJA04996 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: GYF domain 2; Chaperone J-domain superfamily; DnaJ domain; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans rme-8. In C. elegans, rme-8 is involved in several processes, including mechanosensory behavior; positive regulation of nematode male tail tip morphogenesis; and vesicle-mediated transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04996.1 CJA04996.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04996 CJA04996   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-rme-8, AAGTGCGATTCTGGATCTGAAAGTTGGACAGAAGATTTCTGAAATTCTTGACAAGTCTCC, WBGene00124200   Expr1078131 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term