WormMine: Gene WBGene00036490

• WormBase Gene ID: WBGene00036490
• Gene Name: Cbr-msd-4
• Sequence Name: CBG16598
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Major sperm protein (MSP) domain; Immunoglobulin-like fold; MSP (Major sperm protein) domain; and PapD-like superfamily. Is an ortholog of C. elegans W01B6.4 and msd-4 and members of the C. elegans ssp gene class including ssp-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16598.1	CBG16598.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16598	CBG16598		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050670
• Remark: Cbr-msd-3, GCCAAAGGAGGACAAGCTGGTCATTCACTTCGCCGTCGCCCCAGCTGACGCCACTGATGC, WBGene00036490
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term