WormMine: Gene WBGene00060282

• WormBase Gene ID: WBGene00060282
• Gene Name: Cre-che-2
• Sequence Name: CRE17245
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans che-2. In C. elegans, che-2 is involved in several processes, including dauer larval development; negative regulation of transforming growth factor beta receptor signaling pathway; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17245.1	CRE17245.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17245	CRE17245		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095471
• Remark: Cre-che-2, GCTATGCAAGTGGTGCTAACCGGAAAATTGGGAGATGCGGATGTGATGTTGGAAAGGAAC, WBGene00060282
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term