WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029339 Gene Name  Cbr-lin-42
Sequence Name  ? CBG07211 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: PAS domain superfamily and PAS domain. Is an ortholog of C. elegans lin-42. In C. elegans, lin-42 is involved in negative regulation of dauer larval development; negative regulation of miRNA transcription; and regulation of development, heterochronic. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07211b.1 CBG07211b.1   [unknown]
Transcript:CBG07211a.1 CBG07211a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07211b CBG07211b   [unknown]
CDS:CBG07211a CBG07211a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lin-42.1, AATCCAAGACTCTGCCTACAGTAATGGCGAAGACATTTGAGGATGAGCTCAGAACGATTA, WBGene00029339   Expr1055744 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-lin-42.2, ACAACCAACATCAAAACTATAGATCGATGGCGCCGAATCCACCACCACCACCAGGAAAGA, WBGene00029340   Expr1057579 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term