WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060204 Gene Name  Cre-tbc-11
Sequence Name  ? CRE17212 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Rab-GTPase-TBC domain; PTB/PI domain; Kinesin protein; Kinesin-like; Rab-GTPase-TBC domain superfamily; Rab GTPase-activating protein 1; and PH-like domain superfamily. Is an ortholog of C. elegans tbc-11. In C. elegans, tbc-11 is involved in RNA localization and cuticle development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE17212.1 CRE17212.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE17212 CRE17212   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE17212, AAATTGAGACTTCTGCAAATGCCATTGAGCGACTGACACGACAGAATCAAGACATTCTGG, WBGene00060204   Expr1117224 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term