WormMine: Gene WBGene00060023

• WormBase Gene ID: WBGene00060023
• Gene Name: Cre-cle-1
• Sequence Name: CRE29745
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin fold; Fibronectin type III superfamily; Fibronectin type III; Collagen triple helix repeat (20 copies); Immunoglobulin-like fold; Collagenase NC10/endostatin; Collagen triple helix repeat; C-type lectin-like/link domain superfamily; Fibronectin type III domain; Concanavalin A-like lectin/glucanase domain superfamily; and Collagenase NC10 and Endostatin. Is an ortholog of C. elegans cle-1. In C. elegans, cle-1 is involved in several processes, including cholinergic synaptic transmission; generation of neurons; and inductive cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29745.1	CRE29745.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29745	CRE29745		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109407
• Remark: Cre-cle-1, GTCCAAGTACCACGGCGATCGAATCCTCCGTTTGAACCGAATCACCTCCGACTTCAAAAT, WBGene00060023
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term