WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060083 Gene Name  Cre-djr-1.2
Sequence Name  ? CRE29716 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Protein/nucleic acid deglycase DJ-1; DJ-1/PfpI family; DJ-1/PfpI; and Class I glutamine amidotransferase-like. Is an ortholog of C. elegans djr-1.2. In C. elegans, djr-1.2 is involved in cellular aldehyde metabolic process; cellular response to aldehyde; and monocarboxylic acid biosynthetic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29716.1 CRE29716.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29716 CRE29716   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-djr-1.2, ACACGGAATTAAGGTGGATGAGGTCACTGGACATTACAGTGTCAAGGATAAGCTAATCGA, WBGene00060083   Expr1098935 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term