WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00082226 Gene Name  CRE20246
Sequence Name  ? CRE20246 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: BEACH domain; PH-BEACH domain; WD40 repeat; PH domain associated with Beige/BEACH; WD40-repeat-containing domain superfamily; BEACH domain superfamily; Beige/BEACH domain; and WD domain, G-beta repeat. Is an ortholog of C. elegans sel-2. In C. elegans, sel-2 is involved in several processes, including apical protein localization; negative regulation of Notch signaling pathway; and regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20246.1 CRE20246.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20246 CRE20246   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE20246, CATCGTTATATACAAAACAGCTCAGCAACGAGACCCTCGCAACCATCGCCATCGCCTCAA, WBGene00082226   Expr1114464 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term