WormMine: Gene WBGene00127106

• WormBase Gene ID: WBGene00127106
• Gene Name: CJA07902
• Sequence Name: CJA07902
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-type fold; Nucleolar pre-ribosomal-associated protein 1, C-terminal domain; and Nucleolar pre-ribosomal-associated protein 1. Is an ortholog of C. elegans T05H4.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07902.1	CJA07902.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07902	CJA07902		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092093
• Remark: CJA07902, CGGAATGAAACTGCTTTTGAGCTCATTTTCGAGCATTTGGTTGGAAAGAAAGGGGCGTGC, WBGene00127106
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term