WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127093 Gene Name  Cjp-nab-1
Sequence Name  ? CJA07889 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Neurabin-1/2, PDZ domain; Neurabin-like family; Sterile alpha motif domain; PDZ domain; Sterile alpha motif/pointed domain superfamily; SAM domain (Sterile alpha motif); and PDZ superfamily. Is an ortholog of C. elegans nab-1. In C. elegans, nab-1 is involved in synapse assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07889b.1 CJA07889b.1   [unknown]
Transcript:CJA07889a.1 CJA07889a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07889b CJA07889b   [unknown]
CDS:CJA07889a CJA07889a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA16547, AGTTTACGATCAATAAGGTGAACGGAGCAAAGTTTCTCGAGTTGGACGGCACCAAGTTGA, WBGene00135751   Expr1087799 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-nab-1, GAAAAGTTGAAGGAGAAGATTGAGAAGCGGGATGAGGGTTTGGCGTATAAACCGGGCGGA, WBGene00127093   Expr1090914 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term