WormMine: Gene WBGene00062347

• WormBase Gene ID: WBGene00062347
• Gene Name: Cre-dph-6
• Sequence Name: CRE23913
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Diphthine--ammonia ligase/Uncharacterised protein MJ0570; Diphthamide synthase; Rossmann-like alpha/beta/alpha sandwich fold; and Diphthamide synthase domain. Is an ortholog of C. elegans dph-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE23913.1	CRE23913.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE23913	CRE23913		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095599
• Remark: CRE23913, ATGGCTGCAACTATGAAGACTCTTCAAGACAAATATGGAGTTCACCCATGTGGCGAAGGC, WBGene00062347
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term